40 dakika Sınıf/Ünite/Konu: Sınıf/dna ve Genetik Kod Ön biLGİler



Yüklə 109,49 Kb.
tarix08.06.2018
ölçüsü109,49 Kb.

04150032023/Asiye Ayaydın Aktaş, 04150032011/Barış Memur, 04150032016/Naciye Özbey, 04150032051/Nuran Arslan, 04150032010/Rabia Yalçınöz, 04170032604/Rukiye Kocaman, 04130032300/Sureeporn Amoohamadprasert

DNA VE GENETİK KOD


(http://cibt.cornell.edu/labs-activities/labs/protein-synthesis-and-words-2/ adresindeki etkinlikten uyarlanmıştır.)

Etkinliğin Amacı: Gizli bir mesajın çözülmesi benzetmesi kullanılarak, protein sentezi sürecini öğrencilere kavratmak.

Etkinliğin Süresi: 40 dakika

Sınıf/Ünite/Konu: 8.Sınıf/DNA ve Genetik Kod/DNA ve Genetik Kod


ÖN BİLGİLER

NÜKLEİK ASİTLER

19. Yüzyılın sonlarına doğru, İsveçli biyokimyacı Miescher akyuvar çekirdeklerinde ve balıkların sperm hücrelerinin çekirdeklerinde proteinlerle birlikte bazı asitlerin bulunduğunu tespit etmiş ve bunlara çekirdek asitleri anlamına gelen “Nükleik asitler” adını vermiştir. Daha sonraki çalışmalarda tüm ökaryotik canlıların çekirdeklerinde ve bazı organellerinde, çekirdeği olmayan canlıların ise sitoplazmalarında bulunduğu farkedilmiştir. Nükleik asitler, nükleotit olarak adlandırılan birimlerden (monomer) oluşan makromolekülleridir. Nükleotitler organik baz, şeker ve fosforik asit üçlüsünden oluşurlar (Şekil 1). Nükleotitlerin yapılarında C, O, H, N ve P elementleri bulunur.





Şekil 1: DNA’nın yapı birimi nükleotidin yapısı
Nükleotitler taşıdıkları organik baza göre isim alırlar. Örneğin adenin organik bazı bulunduran bir nükleotit “adenin nükleotidi” , timin organik bazı bulunduran bir nükleotit ise “timin nükleotidi” olarak adlandırılır. Nükleik asitlerde 5 çeşit organik baz ve 8 çeşit nükleotit bulunur. Bunun nedeni adenin, guanin ve sitozinin hem ribozla hem de deoksiribozla birleşebilmesidir.

Nükleik asitler taşıdıkları şeker çeşidine göre DNA (DeoksiriboNükleik Asit) ve RNA (RiboNükleik Asit) olmak üzere iki grupta incelenir.



  1. DNA

DNA molekülü bilgi deposudur. Bir hücreyi ya da organizmayı oluşturmak için gerekli tüm bilgileri içerir. Bu bilgiler nükleotidler yardımı ile kodlanmış olarak taşınır. Ökaryotlarda çekirdek içerisinde, prokaryotlarda ise sitoplazmada serbest halde bulunur. Kloroplast ve mitokondrinin içerisinde de DNA vardır ve halkasal şekildedir.

1953 yılında, Cambridge Üniversitesinden James Watson ve İngiliz Fizikçi Francis Crick DNA’nın üç boyutlu yapısına ait önerdikleri modele göre; birbirine zıt yönde uzanan (bir polinükleotidin 5’ ucu, diğerinin 3’ ucu ile karşı karşıya olan) ve hidrojen bağları ile bir arada tutulan iki polinükleotid zincirden oluşan DNA, bir eksen doğrultusunda sağa dönen sarmal bir yapıya sahiptir. Bu sarmalın, dışa bakan kısmında fosfodiester bağları ile bağlı olan şeker ve fosfat molekülleri, içe bakan kısmında ise, ana eksene dikey olarak yer almış olan bazlar bulunur. İki polinükleotid zincirini bir arada tutan ise bazlar arasındaki hidrojen bağlarıdır (Şekil 2). Adenin (A) daima Timin (T) ile ikili bağ, guanin (G) ise sitozinle (C) üçlü bağ yapar.

DNA’nın baz sırası, türler arasında farklılık gösterir. DNA’nın büyüklüğü canlıdan canlıya değişir.

Şekil 2: DNA molekülünün yapısı
DNA'nın temel işlevleri, bir türün sahip olduğu özelliklerin nesilden nesile aktarılmasını sağlamak, canlının yapısında yer alan yapısal ve işlevsel proteinlerin kodlanması ve yaşamın genetik planını oluşturmasıdır. Kısacası DNA, bir organizmanın gelişimine ve çoğaltılmasına - sonuçta hayatta kalmasına - yönelik talimatları içerir. %90 çekirdekte, %10 ise organellerde bulunur.


  1. RNA

DNA’nın aksine, RNA tekli polinükleotid zinciri içeren, nükleik asit molekülüdür. 5 C’lu riboz şekeri, adenin, guanin, sitozin, urasil (DNA’daki timin yerine adeninle eşleşir) organik bazları ve fosforik asitten oluşur. DNA’nın ipliklerinden sentezlenirler. Temel işlevi çekirdekte yer alan ve oradan ayrılmayan DNA’daki genetik bilginin, sitoplazmadaki ribozomlara aktarılmasını ve protein sentezini sağlamaktır.

İşlevlerine göre RNA’lar, 3’e ayrılır (Şekil 3):



  1. mRNA ( Elçi RNA )

  2. tRNA ( Taşıyıcı RNA )

  3. rRNA ( Ribozomal RNA )



Şekil 3: İşlevlerine göre RNA’lar

  1. mRNA: Protein sentezi için gerekli mesajı, çekirdekteki DNA’dan sitoplazmadaki ribozomlara aktaran ve orada protein sentezinde kalıp işlevi gören RNA’lardır. DNA’nın anlamlı ipliğinin karşısında sentezlenir. m-RNA üzerinde 3’lü nükleotit dizilerine kodon adı verilmektedir. mRNA üzerindeki, her biri bir amino asidin sentezi için şifre oluşturan, üçlü baz gruplarına kodon denir (Tablo 1).

Tablo 1: m RNA’daki Kodonlar ve Şifreledikleri Amino Asitler




  1. tRNA: Protein sentezi için gerekli olan amino asitleri, sitoplazmadan alarak ribozomlara taşıyan RNA’lardır. Tek zincir şeklinde olan tRNA molekülü özel bir yerinden ikiye katlanır. Bu katlanan kısma antikodon ucu denir. Antikodon ucunda yer alan üçlü nükleotid, mRNA’daki kodon ile eşleşir. t-RNA’nın daha uzun olan 3’ucuna ise mRNA’daki kodona uygun amino asit bağlıdır (Şekil 4). tRNA’ya daha önce bağlanmış olan amino asit ribozoma taşıyarak amino asit dizisindeki yere bağlanmasını sağlar.

DNA’dan sentezlenir. Sitoplazmada çözünmüş olarak bulunur. t-RNA’lar, protein sentezinde bir nevi, “çevirmen” işlevi görürler. Protein sentezleneceği zaman sitoplazmadaki aminoasitleri yakalayarak ribozomun büyük birimine taşır. Ribozomda mRNA’nın kodonu antikodon tarafından okunur.

Hücrede 64 çeşit t-RNA bulunur. Bunlardan sonlanma kodonlarına karşılık gelen 3 tanesi aminoasit taşımaz. Hücrede 20 çeşit aminoasit olduğuna göre, bazı aminoasitler birden fazla tRNA (antikodonları farklı, taşıdıkları amino asitler aynı olan) tarafından taşınmaktadır.





Şekil 4: t-RNA modeli



  1. rRNA: Protein sentezinin gerçekleştiği organel olan ribozomların yapısında proteinlerle birlikte yer alan RNA’lardır. Ribozomun yapısında mRNA (DNA mesajını taşıyan) ve tRNA (mesajı okuyan ve protein diline dönüştüren) molekülleri için bağlanma bölgeleri bulunur (Şekil 5). Ribozom farklı bileşenleri bir arada tutan mengene işlevini gerçekleştirir. Ribozomda mRNA molekülü, üçer nükleotid (kodon) şeklinde ilerler ve bu kodonlara uygun antikodon içeren tRNA tarafından okunur. DNA’dan sentezlenir.



Şekil 5: Protein ve rRNA moleküllerinden oluşan ribozom alt birimleri ve mRNA ve tRNA moleküllerinin bağlanma bölgeleri
DNA’NIN KENDİNİ EŞLEMESİ

DNA’nı taşıdığı kalıtsal özelliklerin, oğul döllere aktarabilmesi ve meydana gelen iki yavru hücreye eşit olarak aktarılabilmesi için, DNA’nın kendini eşlemesi yani iki katına çıkarması gerekir. Bu nedenle, hücre bölünmeden önce, DNA molekülü hem miktar hem de nükleotit sayısı olarak iki katına çıkar. İnterfaz evresinde çekirdekte gerçekleşen bu işleme, duplikasyon (ikileşme) denir. DNA molekülünün birbirine zıt yönde uzanan iki zinciri, iki yeni DNA zincirinin sentezlenmesinde kalıplık yapmakta ve sonuçta bir DNA’dan birer zinciri eski (ebeveyn(=parental) DNA molekülüne ait ), birer zinciride yeni olmaktadır. Oluşan her iki molekülde, birer zincir korunduğu için, yarı korunumlu (semikonservatif) eşleşme olarak adlandırılmaktadır. Bu süreci kısaca özetleyecek olursak:



  • DNA kendini eşlerken, iki polinükleotit zincirini (ebeveyn DNA) bir arada tutan hidrojen bağları DNA helikaz enzimi yardımıyla koparılarak, tıpkı bir fermuarın açılması gibi, iki zincir birbirinden ayrılır.

  • Ayrılma sonucu ebeveyn zincirlerdeki pürin ve pirimidin uçları açıkta kalır. Her bir ebeveyn zincir kalıp işlevi görür.

  • Açıkta kalan purin (veya pirimidin) karşısına sitoplazmadan uygun pirimidin (veya pürin) nükleotidleri gelerek eşleşir. Eşleşme daima 3’ ucundan başlar. Çünkü DNA polimeraz, mononükleotid birimlerini, DNA zincirinin serbest 3’-OH ucundan başlayarak 5’-fosfat ucuna doğru okur. Bu nedenle, yeni sentezlenen DNA zincirinin sentez yönü daima, 5’ ucundan 3’ ucuna (5’ → 3’) doğru gerçekleşir.

  • DNA polimeraz enzimi yardımıyla eşleşen nükleotidler, DNA ligaz enzimi ile de bu nükleotidler arasında fosfodiester bağları oluşturularak zincirin uzaması sağlanır. Yeni zincirlerden biri (leading (ana)) kesintisiz şekilde sentezlenirken (tek bir primer görev aldığından), diğeri (lagging (kesintili)) Okazaki parçacıkları olarak adlandırılan parçalar (çok sayıda primer görev alır) halinde oluşur ve DNA ligaz tarafından tek tek birleştirilir.

  • Böylece bir zinciri ebeveyn zincir, diğeri ise yeni oluşan zincir olmak üzere iki DNA molekülü meydana gelmiş olur (Şekil 6).



Şekil 6: DNA’nın kendini eşleme süreci
DNA molekülü aynı zamanda, bir canlının tüm hücrelerinde gerçekleşen temel yapı ve işlevleri için gerekli proteinlerin yapımını da yönetir. Ama DNA molekülü, ökaryotik canlılarda çekirdekte bulunur, protein sentezi ise, sitoplazmada gerçekleşir.


GENETİK BİLGİNİN AKIŞI: MERKEZİ DOGMA

Çekirdekte bulunan DNA’nın taşıdığı yönergelerin, işlevsel bir ürüne (proteine) dönüştürülebilmesi için sitoplazmaya aktarılması gerekir. DNA çekirdekten ayrılmadığına göre, bu işlev, bir başka nükleik asit çeşidi olan çeşitli RNA’lar tarafından gerçekleştirilmektedir. İşte, DNA bilgisinin, RNA molekülleri aracılığı ile proteinlere çevrilmesini sağlayan bu süreç Merkezi Kabul (Central Dogma) olarak adlandırılmaktadır (Şekil 7).





Şekil 7: DNA’dan protein sentezi sürecini açıklayan Santral Dogma (Merkezi Kabul)
Protein sentez sürecini açıklayan bu hipotez 1958 yılında, Francis Crick tarafından ortaya atılmıştır. O dönemde tek yönlü bir süreç olarak kabul gören bilgi akışının, daha sonra RNA virüslerinin (Grip ve AIDS’e yol açan virüsler gibi) keşfi ile, RNA’dan DNA’ya ve sonra tekrar RNA ve Protein şeklinde de gerçekleştiği belirlenmiştir.

PROTEİN SENTEZİ: GENDEN PROTEİNE

Hiç bir canlı, dış ortamdan aldıkları proteinleri doğrudan yapı ve enzim olarak kullanmaz. Aldıkları proteinleri amino asitlerine ayrıştırdıktan sonra kendi ihtiyacına uygun proteinleri kalıtsal yapısına uygun olarak kendisi sentezler.

Proteinler, binlerce amino asitin bileşiminden oluşan polipeptitlerdir. Polipeptitler, 20 farklı amino asitin DNA’daki diziye uygun olarak sıraya konmuş ve aralarında bir amino asitin amino grubu (-NH2) ile, diğerinin karboksil grubu (-COOH) arasında peptid bağları ile bir arada tutulan makromoleküllerdir. Tıpkı DNA’daki nükleotid dizisinin her canlıya özgü olması gibi, bu nükleotit dizisindeki şifreye göre diziye aktarılan amino asitlerin farklı düzenlemesi de, her proteini benzersiz kılar. Proteinler, hücre protoplazmasının ve yapısının temel bileşenleridir.

Protein sentezi; transkripsiyon (yazılım) ve translasyon (çeviri=okunma) olmak üzere iki süreçten oluşur.



  1. TRANSKRİPSİYON: Çekirdekteki DNA’nın özel bir bölgesinden (ilgili geni içeren) mRNA’nın sentezlendiği sürece denir. Transkripsiyon süreci şu basamaklardan oluşur:

  1. DNA’nın sentezlenecek proteinin şifresini taşıyan (transkripsiyon birimi) bölgesindeki promotör olarak adlandırılan özel bir dizisine (3’ ucunda yer alır), RNA polimeraz bağlanır ve DNA’nın sarmal yapısını çözer. Oluşan bu yapıya replikasyon çatalı denir.

  2. Sentezlenecek proteinin şifresini oluşturan DNA zincirine anlamlı zincir, karşısındaki zincire ise, tamamlayıcı zincir denir. DNA’nın anlamlı zinciri, mRNA’nın sentezinde kalıp olarak kullanılır. mRNA sentezlenirken ribonükleotidler (A, C, G ve U) kalıp DNA zincirinde bulunan uygun deoksiribo nükleotidlerle eşleşir. RNA’da Adenin karşısına Timin nükleotidi yerine Urasil nükleotidi gelir. Bu işlem, gen veya sonlandırma dizisinde ait bir "işarete" rastlayana kadar bir devam eder. mRNA sentez yönüde DNA replikasyonunda olduğu gibi sentez, 5’ ucundan 3’ ucuna (5’ → 3’) doğru gerçekleşir.

DNA’nın yapısındaki 4 çeşit nükleotitin, 20 çeşit amino asidi şifrelemesi gerekir. DNA’daki nükleotitlerden üçlü kombinasyonlarla 43=64 farklı şifre elde edilir. DNA’da bir amino asidi şifreleyen üçlü nükleotit dizilerinin her birine genetik şifre ya da genetik kod denir. mRNA’daki üçlü nükleotit dizilerinin her birine kodon, tRNA ise antikodon adını alır. 64 kodondan üç tanesi (UAG, UAA, UGA) amino asit şifrelemez. Bunlar protein sentezinin bittiğini haber veren durdurucu (stop) kodonlardır. O halde amino asit şifreleyen kodon sayısı 61’dir (Bakınız Tablo 1). İki amino asit dışındaki bütün amino asitlerin birden fazla kodonu bulunur.

  1. Sonlandırma kodonlarında birine denk geldiğinde RNA polimeraz nükleotit eklemeyi durdurur. Sentezlenen mRNA’nın ilk kodonu, metyonin amino asitini sentezleyen kodondur. mRNA sentezlenince çekirdek porlarından geçerek sitoplazmadaki ribozomlara gider. DNA iplikleri ise tekrar birleşir.

  2. Prokaryotik canlılarda bu işlem sitoplazmada gerçekleşir ve sentezlenen mRNA’nın doğrudan sitoplazmadaki ribozomlara gider. Ökaryotik canlılarda ise, sentezlenen pre(öncü)-mRNA ribozomlara gitmeden önce çekirdekte işlenir. İşleme işlemi sırasında 3’ucuna poli-A kuyruğu, 5’ ucuna ise çok sayıda Guanin dizisinden oluşan cap olarak adlandırılan nükleotit dizileri eklenir. Pre-mRNA’daki intron olarak adlandırılan her hangi bir amino asiti şifrelemeyen kısımlar kesilip uzaklaştırılır. Eksonlar birbirine eklenir. Daha sonra mRNA, çekirdek porlarından geçerek sitoplazmadaki ribozomlara gider. DNA iplikleri ise tekrar birleşir.




  1. TRANSLASYON: Ribozomlarda tRNA’larında yardımıyla mRNA’dan polipeptitlerin sentezlendiği işlemlerden oluşmaktadır.

  1. mRNA, ribozomun küçük alt birimindeki mRNA bağlanma yerine 5’ucundaki cap dizisini bağlar ve AUG kodonuna ulaşıyıncaya kadar ilerler. Ribozomun büyük alt birimi küçük alt birim ile birleşir. Böylece, translasyonunu başlangıç kompleksi tamamlanmış olur. Daha sonra, sitoplazmadaki amino asitleri ribozomlara taşımakla görevli tRNA’lar çalışmaya başlar.

  2. tRNA’lar, en küçük RNA çeşididir. tRNA’ların bir ucuna amino asit bağlanırken, bir başka ucunda ise, üç nükleotitten oluşan antikodon bulunur. tRNA, translasyon sırasında mRNA’daki kodon dizisine uygun sitoplazmadaki amino asitleri ribozomlara taşır. mRNA’daki başlangıç AUG kodonu ile eşleşen, metiyonin amino asiti yüklü başlatıcı tRNA (UAC antikodonu içeren), ribozomun P bölgesine bağlanır. Böylece mRNA’daki kodon ile tRNA’daki antikodon geçici bağ oluşur. A bölgesi ise henüz boştur. A bölgesine, ikinci kodona uygun antikodon içeren tRNA gelip yerleşir. A ve P bölgesinde bulunan tRNA’ların taşıdıkları amino asitler arasında enzim yardımıyla peptit bağı oluşur. Bu esnada bir molekül su çıkar. Okunan mRNA kodonu ribozom üzerinde kayarak yerini yeni bir kodona bırakır. Bu sırada P bölgesinde bulunan tRNA E bölgesine ve A bölgesinde bulunan tRNA da P bölgesine hareket eder. A bölgesine ise, üçüncü kodona uygun antikodon içeren tRNA gelir (Şekil 5). mRNA ribozomun üzerinde bir şerit gibi kayar­ken, her kodona uygun ankitodonlar uygun aminoasit­leri de yan yana dizmiş olur. Aminoasitler ribozom üzerinde yan yana geldikçe uygun enzimler aracılığı ile aralarından su çıkararak peptit bağı oluştururlar. Çok sayıda aminoasit peptit bağlarıyla birleşerek polipeptit zincirini oluşturur.

  3. Daha sonra ribozomun okuduğu bilgiye göre, tRNA molekülleri sitoplazmadaki aminoasitleri bağlayarak ribozoma getirir. İlk tRNA’nın taşıdığı aminoasit okunduktan sonra, tRNA’dan koparak ikinci tRNA’nın taşıdığı aminoasitle birleşir. Bu birleşmede bir peptit bağı kurulur ve bir molekül su açığa çıkar. Aminoasidini bırakan t-RNA ise ribozomdan dışarı çıkarak yerini yeni bir t-RNA’ya bırakır.

  4. Aminoasitlerin tRNA ile taşı­nabilmesi için özel enzimler ve ATP ile aktifleştirilmesi gerekir.

  5. Böylece her taşınan aminoasit, sentezlenen protein içinde yerini alır.

  6. Protein sentezi mRNA’daki tüm kodonlar ribozomda okununcaya kadar devam eder. mRNA’nın taşıdığı kodonlar arasında bulunan, UAA, UAG, UGA kodonlarının okunması durumunda ise protein sentezi son bulur (Şekil 8).

  7. Protein sentezinin sona ermesi ile en son sentezlenen amino asit tRNA’dan ayrılır. Bu ayrılma ile mRNA serbest kalır. Bu olayların gerçekleştiği sırada ribozomun küçük alt birimi ve büyük alt birimi bir birinden ayrılır.

  8. Ribozomda ayrılan polipeptit zinciri yapısındaki amino asit dizisine göre üç boyutlu şekil alır. Bu şekil her proteine özgüdür.


Şekil 8: Hemoglobin proteininin sentezlenme aşamaları

YÖNTEM

ETKİNLİK: Protein Sentezi Sürecinin Simulasyonu

ETKİNLİĞİN AMACI: Bu etkinlikte Protein Sentezi süreci, gizli bir mesajın şifresinin çözülmesi benzetmesi kullanılarak anlatılacaktır. Öğrenciler, DNA-Yazılım-Çeviri (DNA-mRNA-tRNA-Protein) aşamalarını kendi kendilerine öğrenecekler ve DNA şifresini amino asit dizisine dönüştüren anlamlı cümleler oluşturacaklardır. Etkinlik aynı zamanda baz çiftlerini eşleştirebilme ve takip eden süreçte hücrede gerçekleşen olaylar dizisi konusunda da uygulama olanağı sağlayacaktır. Ayrıca uygulama, yeni DNA mesajları oluşturarak başkaları tarafından biyolojik olarak şifresinin çözülebileceğini gösterme olanağı da sağlayacaktır.
Araştırma Sorusu: Protein sentez sürecini öğrenilmesini kolaylaştırmak için nasıl somutlaştırabiliriz?

Etkinliğin Yapılışı:

    1. EK 1’deki, Kalıp DNA kartları (DNA Gen Dizisi) ve Ek 2’deki mRNA Kodonlarına uygun antikodon (tRNA’yı temsil eden ve mRNA’daki kodonlara uygun antikodon ve amino asit içeren) kartlarını hazırlayınız.

    2. Antikodon Sözcük Kartlarını laboratuvarın etrafında kolayca görülebilecek yerlere asınız (Şekil 10).

    3. Hazırlanan kartlar öğrencilere gösterilir ve ne yapmaları gerektiği anlatılır.

    4. Öğretmen masasının çekirdeği temsil ettiğini ve DNA kalıplarının çekirdekten ayrılmadığı belirtiniz.

    5. Öğrencilerden tek tek gelip Kalıp DNA kartlarından birini alıp ellerindeki Çalışma Kağıdına kartın numarasını yazmalarını ve bu kalıpları mRNA’ya kopyalamalarını isteyiniz.

    6. Öğrenciler, mRNA dizileri ile gruplarının olduğu sıraya gitsinler ve rRNA’yı temsil eden öğrenci, tRNA antikodon dizisini yazsın.

    7. tRNA’yı temsil eden öğrenciler doğru antikodon kartlarını bularak ve sözcüğü gösteren kartı duvardan alsınlar. Karttaki sözcüğü ellerindeki diziye uygun yere yazsınlar.

    8. Cümle bu şekilde tamamlandıktan sonra, öğrencilerden cümlelerini okumalarını isteyiniz. Eğer cümleler doğru değilse aynı DNA kartları öğrencilere tekrar dağıtınız ve hataların bulunması isteyiniz. Doğru ise, başka bir kart verin.

NOT: Etkinliğimizde Tablo 1’deki mRNA kodon tablosunda bulunan amino asitlere karşılık olarak Tablo 2’de verilen sözcükler yer almaktadır.

Şekil 9: Etkiliğimizde AAA kodonunun karşılığı olan “Aziz” sözcüğünü (amino asit) ve “UUU” antikodonunu taşıyan tRNA

GEREKLİ MALZEMELER:

  • 20 tane çift sarmallı DNA

  • 64 tane Antikodon kartı

  • 20 tane mRNA dizilerini oluşturmak için boş kağıt (Grup başına)

  • 20 tane ribozom niteliği taşıyan kartonlar

  • Kalem


!!! ETKINLIĞIMIZDEKI ILK ŞIFREYI BIRLIKTE ÇÖZELIM.
DIZI NUMARASI: 1


DNA


TACCTTTGTGCGATTCATCTAATC

mRNA


AUG-GAA-ACA-CGC-UAA-GUA-GAU-UAG

tRNA


UAC-CUU-UGU-GCG-AUU-CAU-CUA-AUC

Cümle


  • HAYATTA EN HAKİKİ MÜRŞİT BİLİMDİR FENDİR.


SONUÇ VE DEĞERLENDİRME

Etkinlikten önce yaptığımız hazırbulunuşluk testinde, öğrencilerin büyük bir kısmının DNA’nın kendini eşlemesi sırasında gerçekleşen olayların gerçekleşme düzenini tam olarak bilmedikleri test edilmiştir. Bununla birlikte protein sentezi ile ilgili olan anlamsız zincir üzerinde verilen nükleotit dizisini anlamlı zincir, mRNA ve tRNA dizilerine çeviremediklerini ve buna bağlı olarak polipeptitteki aminoasit cümlesini oluşturamadıkları gözlemlenmiştir. Ek 1’de yer alan hazırbulunuşluk testinin 1.sorusu genel olarak doğru cevaplanmıştır. Testin 4. sorusu ise, öğrencilerin % 85’i tarafından doğru cevaplanmamıştır. Etkinlik ve konu anlatımından sonra, DNA’nın kendini eşleme ve protein sentezi mekanizmalarının öğrenciler tarafından kavranıldığı gözlemlenmiştir. Buna bağlı olarak öğrenciler translasyon ve transkripsiyon arasındaki farkı doğru olarak tanımlamışlardır. Ek 1’de yer alan hazırbulunuşluk testi 100 puan üzerinden değerlendirmeye tabii tutulmuştur. Bu testin öğrenci sayısı – not ilişkisi de şu şekildedir.



  • 1-10 puan arası 12 kişi,

  • 11-20 puan arası 6 kişi,

  • 21-30 puan arası 5 kişi,

  • 31-40 puan arası 7 kişi,

  • 41-50 puan arasında puan alan öğrenci yok,

  • 51-60 arası ise 5 kişi.



GERİ DÖNÜT SORULARI

  1. DNA neden çekirdekten çıkmaz? Çıksaydı ne olurdu?

  2. Bilim insanımız Prof. Dr. Aziz Sancar’a 2015 Nobel Kimya Ödülünü almasını sağlayan çalışması ne üzerinedir? Araştırınız.

  3. EK 2’deki mRNA kodonları tablosundan faydalanarak verilen şifrelerden farklı bir cümle oluşturunuz. Bu cümleye ait DNA, mRNA, tRNA dizisini yazınız.


GÜNLÜK YAŞAMA UYARLAMA VEYA GÜNLÜK YAŞAMDAN ÖRNEKLER

Proteinler vücudumuzdaki birçok hayati fonksiyonun enerji kaynağıdır. Bu sebeple protein sentezi bizler için önemli bir mekanizmadır. Protein bedenimizdeki insülin, melatonin ve seratonin gibi birçok hormonun salgılanmasına doğrudan doğruya yardımcıdır. Tüm bu hormonlar gibi kaslarımızın gelişmesi aşamasında da onarım ve bununla birlikte daha çok önemi büyüme için proteinin önemi yadsınamaz.


KAYNAKLAR
http://cibt.cornell.edu/labs-activities/labs/protein-synthesis-and-words-2/ adresindeki etkinlikten uyarlanmıştır.
Prof. Dr. Afyon, A., Yrd. Doç. Dr. Kaya, M.A., Yrd. Doç. Dr. Yağız, D., Nükleik Asitler, Canlılar Bilimi, Nobel Basımevi, Ankara, 2004, s.86-92

http://80.251.40.59/veterinary.ankara.edu.tr/fidanci/Ders_Notlari/Ders_Notlari/Nukleik_Asitler.html (Erişim tarihi: 23.04.2018 )
https://www.slideshare.net/HikmetGekil/biyokimya-nkleik-asitler (Erişim tarihi: 07.05.2018 )

http://www.lisebiyoloji.com/protein%20sentezi.html (Erişim tarihi: 23.04.2018 )


  • Resimler aşağıdaki internet adreslerinden alınmıştır




  • https://www.fenbilim.net/2014/07/8-sinif-dna-ve-genetik-kod.html ( 23.04.2018 )


  • https://www.google.com.tr/search?biw=1366&bih=613&tbm=isch&sa=1&ei=Kh3eWpHGKuXI6ASxz4qQCQ&q=protein+sentezi&oq=protein+sentezi&gs_l=psy-ab.3..0l10.1449167.1452783.0.1459165.15.9.0.5.5.0.316.838.0j3j0j1.4.0....0...1c.1.64.psy-ab..6.9.854...0i67k1.0.XjijBqmYntE#imgrc=_ ( 23.04.2018 )




  • https://www.google.com.tr/search?biw=1366&bih=613&tbm=isch&sa=1&ei=4CLeWuLREMaisgGk7I9g&q=santral+dogma&oq=santral+dogma&gs_l=psy-ab.3..0l3j0i30k1l3j0i24k1l4.469366.474279.0.474641.13.11.0.2.2.0.296.2112.0j3j7.10.0....0...1c.1.64.psy-ab..1.12.2117...0i67k1j0i10k1.0.oxAsIoUNaNQ#imgrc=_ ( 23.04.2018 )




  • http://slideplayer.com/slide/4047443/13/images/1/DNA+STRUCTURE+DNA+is+composed+of+polynucleotide+chains.jpg (Erişim tarihi: 07.05.2018 )

  • http://slideplayer.com/slide/4047443/13/images/2/Formation+of+Nucleotides.jpg (Erişim tarihi: 07.05.2018 )


EK 1: DNA GEN DİZİSİ (ŞİFRELİ CÜMLELER)

  1. TACCTTTGTGCGATTCATCTAATC

  2. TACGAGGGATTCATC

  3. TACTCTTAAGGGATC

  4. TACGTAAAACAGTGAAGAATC

  5. TACTTTTTGCGACATTCCTCGATC

  6. TACTTTTTGGGGCGCTAGAATATC

  7. TACCTAGATTGTACTCATAAGATC

  8. TACCTAGATAGGCACATC

  9. TACCTGGAAGTCGGGGTGCGTCAAAGCATC

  10. TACGTTTCAGCTATC

  11. TACTCTCATCCCCGTACAAGCATC

  12. TACGCTAGTGACATC

  13. TACGCCACCCCCGTTATC

  14. TACATGCCCTGTCCACGGATC

  15. TACCTATTCAGGCACATC

  16. TACGGGCCGCCGCCTATC

  17. TACAAGCATCCCAGCATC

  18. TACCTGAGTGTGCAAGAAATC

  19. TACGCTGACGGCGGTATC

  20. TACGTTAGTACGGCATGCATACTCATAAGTTGGGCATTAATC


EK 2: mRNA KODONLARI (HER BİR KODONUN

SÖZCÜK KARŞILIKLARI)

UAG = . (Sonlandırma)

CCG = Göreceğiz

CGC = Hakiki

AUG = - (Başlama)

CCU = Kurtaranlar

CGG = Yeryüzünde

AAA = Aziz

CGA = Güzel

CGU = Gibi

GAC = Bu

AAG = Öğretmen(i)/(lerdir)

AAU = Kardeşçesine

ACG = Tek

ACC = Orman

ACU = Daha

ACA = En

AGA = Evrim(in)

AGG = Ödülü(ne)

AGU = Çok

AGC = Aldı

AUA = Yapmalıdır

AUC = Mekanizmasını

AUU = Dili

CAA = Yaşamak(tadır)

CAC = Protein(lerin)

CAG = İle

CAU = Artvin’in

CCA = Çocuklar

CCC = DNA(dan)

CUA = Öğretim(i/nin)

CUC = Milletleri

CUG = Gün(ler)

CUU = Etkinlik(ğ)idir

GAA = Hayatta

AAC = SANCAR

GAG = Hür

GAU = Fen(dir)

GCA = Nasıl

GCC = Birimidir

GCG = Tamir

GCU = Nobel

GGA = Aktarılır

GGC = Nesil(e/den)

GGG = Canlı(yı/lar(/n)ın)

GGU = Küçük

GUA = Bilim(i/dir)

GUC = Altından

GUG = Olmalıdır

GUU = Sentez(i/lendiğini)

UAA = Murşit

UAC = Hücre

UAU = Ve

UCA = Bir

UCC = Sorgulayıcı

UCG = İncele(r/yeceğiz)

UCU = Değerlidir

UGA = Kapsamlı

UGC = Ağaç

UGG = Milyonlarca

UGU = Çeşitlendiğini

UUA = Çalışıyor

UUC = Biyoloji(dir)

UUG = Öğreneceğiz

UUU = Üstü








EK 3: ÇALIŞMA KAĞIDI

DİZİ NUMARASI: …………….

DNA





mRNA





tRNA





Cümle






EK 4: HAZIRBULUNUŞLUK TESTİ

AD SOYAD: ………………………………… TARİH: …………


  1. Aşağıdaki terimleri tanımlayınız.

Gen:

Kodon:

Merkezi dogma:

İnsan Genom Projesi:

Transkripsiyon:

  1. Bir canlıya ait genom bilgisini nerelerde kullanabiliriz? Belirtiniz.



  1. Transkripsiyon ve translasyon arasındaki farklar nelerdir? Açıklayınız.



  1. Hemoglobin molekülünün -zinciri,146 amino asit içermektedir. Bu polipeptiti şifreleyen gen:

  1. Olası kaç nükleotidten oluşmaktadır?



  1. Kaç kodondan oluşmaktadır?



  1. Aşağıda DNA’nın kendisini eşlemesi sırasında gerçekleşen olaylar karışık olarak verilmiştir.Olayları numaralarını kullanarak meydana geliş zamanlarına göre sıralayınız.


1

Birbirinin birebir kopyası iki adet DNA oluşur.

2

DNA’nın iki ipliğini bağlayan bağlar kopar.

3

Sitoplazmada serbest halde bulunan nükleotidler çekirdeğe girer.

4

DNA bir fermuar gibi açılır.

5

DNA zincirindeki şifreye uygun olacak şekilde eşleşir ve yeni iplik yazılır.
Meydana geliş sırası: … → … → … → … → …

  1. Aşağıda verilen nükleotit dizisini temel alarak istenilen dizileri yazınız.

Anlamsız Zincir

ACA GCC CTT CGC TGC CTC ACT CGA ATT AAA TAT TTG CCA CTC GCT ATC


Anlamlı

Zincir




mRNA



tRNA



Polipeptitteki

amino asit dizisi






NOT: Amino asit dizisini yazmak için “Kodonlar ve Şifreledikleri Amino Asitler” tablosundan faydalanınız. Kodonu okumak için Tablodaki “Birinci Baz” “İkinci Baz” ve “Üçüncü Baz” yazan kısımlardan sırasıyla üçlü nükleotit dizisini belirleyiniz ve o dizinin karşısında yazan amino asit ismini bulunuz. Örneğin, ACG kodonunun hangi amino asiti şifrelediğini bulmak için; sol taraftaki “Kodonun 1. Bazı” yazan kısımdan A satırına, üstteki “Kodonun 2. Bazı” yazan kısımdan C sütununa, sağ taraftaki “Kodonun 3. Bazı” yazan kısımdan G’nin birleştiği satıra baktığımızda ACG kodonunun Treonin (Thr) amino asitini şifrelediğini bulabiliriz.

Tablo: Kodonlar ve Şifreledikleri Amino Asitler




Şekil 9: Etkinlik sırasında öğrencilerin Kalıp DNA kartlarını seçtikleri an.



Şekil 10: tRNA’ları temsilen, sözcükleri (Amino asit) ve antikodonları (mRNA’daki kodonlara uygun) taşıyan kartlar.



Şekil 11: Uygun sözcüklerin arandığı (tRNA’yı temsilen) anlardan biri



Şekil 12: Şifrenin çözümünün (protein sentezi) gerçekleştirildiği anlardan biri


Dostları ilə paylaş:


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©genderi.org 2019
rəhbərliyinə müraciət

    Ana səhifə