Bariloche protein symposium argentine society for biochemistry and molecular biology

68
BIOCELL, 27 (Suppl. I), 2003
MI-P34.
STRUCTURAL ANALYSIS OF XANTHAN
Karin Hagelin, Maximina Yun, Adrián Vojnov and Marcelo Dankert.
IIB, Fundación Instituto Leloir, Buenos Aires, Argentina. E-mail:
[e-mail]
The biosynthesis of the extracellular polysaccharide xanthan in
Xanthomonas campestris pv.  campestris  is directed by a cluster
of 12 genes, gumB–gumM. Several xanthan-deficient mutants of
the wild-type strain 8004 which carry Tn5 insertions in this region
of the chromosome have previously been described. One of the
mutants, the strain 8397, showed that the transposon insertion
was located 15 bp upstream of the translational start site of the
gumB  gene and was unable to synthesis xanthan. A subclone of
the gum gene cluster carrying gumB and gumC restored xanthan
production of strain 8397 to levels approximately 28% of the wild-
type, demonstrating that gumB and gumC are both involved in the
polymerization and translocation of xanthan across the bacterial
membranes. But it is not clear whether this low recovered activity
is due to the formation of few long polysaccharide chains or to
shorter chains. Another Tn5 insertion mutant, with a reduced slimy
phenotype has been characterized. This mutant failed to produce
the pentasaccharide repeating-unit of xanthan. Only three sugars
were transferred to the prenyl phosphate intermediate and it was
the precursor of a new polymer, a polytrisaccharide, that was
detected in vitro and in vivo. It is shown  that the gumB and gumC
overexpression modify the degree of polymerization of both
xanthan and polytrisaccharide. To achieve these results new
techniques like pulse field electrophoresis and atomic force
microscopy were applied.
MI-P35.
MOLECULAR IDENTIFICATION AND TYPING OF
LACTOBACILLI ISOLATED FROM KEFIR GRAINS
Hollmann A
1
, Delfederico L
1
, Martínez M
1
, Iglesias NG
1
, De Antoni
G
 2
 and Semorile L
1
.
1
Laboratorio de Microbiología Molecular, DCYT, UNQ, Bernal,
2
CIDCA, Cs. Exactas, UNLP. E-mail: [e-mail]
Kefir is a fermented milk prepared from kefir grains. The grains
are clusters of microorganisms held together by a matrix of
polysaccharides and proteins that include primarily lactic acid
bacteria, yeasts and acetic acid bacteria. The aims of this work
were the molecular identification and typing of 17
heterofermentative lactobacilli isolated from kefir grains (CIDCA,
Cs. Exactas, UNLP). The identification of two isolates was made
by sequencing of the PCR product of 16S rDNA gene. In all the
isolates, this gene was analyzed by ARDRA (Amplified Ribosomal
DNA Restriction Analysis), using the restriction enzymes Hae III,
Dde I, Alu I and Eco RI. The genotyping was performed by analysis
of RAPD-PCR (Random Amplified Polymorphic DNA) patterns using
primers M13 (GAGGGTGGCGGTTCT), Coc (AGCAGCGTGG),
ERIC-2 (AAGTAAGTGACTGGGGTGAGCG) and 1254
(CCGCAGCCAA). The analysis of 16S rDNA subunit sequences
showed that both isolates belong to the species Lactobacillus kefir.
The patterns obtained by ARDRA were identical in all the isolates
and in the reference strain Lb. kefir JCM 5818, whereas a
homofermentative lactobacillus showed a different pattern. Lb.
brevis JCM 1059 showed a different ARDRA pattern with the
enzymes DdeI and Alu I. The RAPD-PCR patterns obtained with
the four primers used allowed the differentiation of lactobacilli
isolates. The resulting unrooted phylogenetic tree grouped the 17
isolates in six clusters.
MI-P36.
PRE-mRNA PROCESSING IN TRYPANOSOMATIDS: SR
NETWORK PROTEINS INVOLVED IN CIS- AND TRANS-
SPLICING REACTIONS
Lobo, Guillermo S.; Portal, Daniel; Bonomi, Hernan R.; Flawiá,
Mirtha M.; Torres, Héctor N.
Instituto de Ingeniería Genética y Biología Molécular. UBA. Bs.
As. Argentina. E-mail: [e-mail]
Regulation of gene expression in trypanosomatids is mostly exerted
at the post-transcriptional level, including pre-mRNA maturation,
stability and translation. Cis-splicing has recently been described
in trypanosomatids.  The  trans- and cis-spliceosome contain
conserved elements, that include snRNPs and non-snRNPs. SR
proteins, which  are the main non-snRNPs components of this
structure, and its corresponding kinases conform the SR-Network.
The charcharacterization of Trypanosoma cruzi SR protein (TcSR)
and SR protein kinase in Trypanosoma cruzi and Trypanosoma
brucei have been reported by our laboratory. TSR1 (T. brucei SR-
like) is highliy homologous with TcSR, but has not functional
activity in splicing reaction. Nowadays, three main issues are being
implemented: 1) We are finishing the adaptation of a T. brucei
splicing system, to study cis-/trans-splicing in T. cruzi, particulary
in strains overexpressing SR-Network proteins. 2) TSR1 functions
are being tested, both in HeLa splicing and S. pombe
complementation assays. 3) To overcome the difficulty in obtaining
RNA knockdown mutants in T. cruzi, we take advantage of the
success of RNAi in T. brucei, to study how the depletion of SR-
Network proteins affects pre-mRNA processing in the parasite.
MI-P37.
COMPARATIVE ANALYSIS  OF THE  N- AND  C-TER-
MINAL REGIONS OF Escherichia coli AND Pseudomonas
aeruginosa MutL PROTEINS
Jacquelin DK, Burgos I, Argaraña CE and Barra JL.
Depto. de Química Biológica, CIQUIBIC, Fac. Cs. Quím., UNC.
Ciudad Universitaria, 5000-Córdoba, Argentina. E-mail:
[e-mail]
 In Escherichia coli, DNA mismatch repair (MMR) is initiated by
MutS binding to a mismatch followed by MutL binding. MutL
activates the endonuclease MutH which cleaves the unmethylated
daughter strand at GATC sites. We showed that Pseudomonas
aeruginosa  mutL  gene restore approximately 80% the MMR
system of an E. coli  mutL mutant strain. This is an interesting
result considering that mutS and mutL, but not mutH  homologues
have been found in the genome of P. aeruginosa. The first 327
residues of P. aeruginosa and E. coli MutL proteins have 63% of
sequence homology and 87% of homology in the predicted
secondary structure. In this region, 22 of the 23 amino acids found
to be important for the function of MutL in E. coli are present in
the P. aeruginosa MutL protein. By contrast, the 300 C-terminal
residues have only 18% of sequence homology, but 85% of
homology in the predicted secondary structure. MutL chimeric
proteins containing the E. coli N-terminal region and the P.
aeruginosa C-terminal region or vice versa, also complement
(~80%) the MMR system of an E. coli mutL mutant strain. We are
analyzing in vitro, the capacity of the wild type and chimeric MutL
proteins to interact with and to stimulate the MutH endonuclease
activity. These results support the hypothesis that the N-terminal
region of MutL contains most of the functional activities for the
MMR system, while the C-terminal region is involved principally
in the dimerization of the protein.

---