Genomun nukleotid ardıcıllığının oxunma prinsipləri By: Ocaqi Cavid



Yüklə 25,02 Kb.

tarix29.04.2018
ölçüsü25,02 Kb.


Genomun nukleotid ardıcıllığının 

oxunma prinsipləri   

By: 

Ocaqi Cavid

 





Genomun 

Sanger

 üsulu əsasında nukleotid 

ardıcıllığının oxunması 

 

1974-cü  ildə  iki  fərqli  qrup,  biri  İngiltərədə  Fredrik  Sanger 



tərəfindən  və  digəri  Amerikada 

Maxam

  və 

Gilbert

  tərəfindən 

eyni  zamanda  genomun  nukleotid  ardıcıllığının  oxunmasına 

nail  olmuşlar  və  1980-ci  ildə  birlikdə  Nobel  mükafati  ilə  təltif 

edilmişlər.   


Sanger tərəfindən izah edilmiş metod asan və eyni zamanda 

DNT-nin  təbii  amplifikasiya  proseslərinə  tam  oxşar  

olduğundan, 

Sanger-in 

şərəfinə 

sanger 

üsulu 

adlandırılmışdır.  


Eyni 

zamanda 

dideoxy 

ardıcıllığının 

oxunması 

(didoxy 

sequencing) 

və  həmçinin 

zəncirin  terminasiyası 

(chain 

termination)  kimi  adlanan  Sanger  metodu  dideoxy  nukleotidləri 

(ddNTP’s) və normal nukleotidlərin əsasında həyata keçirilir. 

 

Dideoxy nukleotidləri mahiyyətcə normal nukleotidlərə oxşar olub, 

3’  karbon  hissəsində 



hidroksil

  (OH)  qrupu  əvəzinə, 

hidrogen

  (H) 

atomuna malikdirlər.   

 

  

 




Didoxcy  nukleotidləri  kimi  modifikasiya  olunmuş  nukleotidlər, 

bir  sequencing  daxilinə  integrasiya  olunan  zaman  digər 

nukleotidlərin əlavə edilməsinin qarşısını alır.  

Didoxcy  nukleotid  ilə  sequencing-ə  qoşulan  növbəti  nukleotid 

arasında  fosfodiefir  rabitəsi  yarana  bilmədiyindən,  DNT 

zəncirinin qurulması (uzanması) sona çatır.    


Praymer

 

5'



GAATGTCCTTTCTCTAAG

3' 


Fərz  edək  ki,  aşağıda    göstərilən  49  nukleotiddən  ibarət  bir 

DNT fraqmentinin ardıcıllığını oxumaq istəyirik.    

 

DNT  sintez  edilən  zaman  nukleotidlər  DNT  polimeraza 



vasitəsilə  artırılan  zəncirə  əlavə  olunmağa  başlanırlar.  Lakin 

DNT zənciri artırılan zaman normal nukleotid yerinə zəncirdə 

dideoxcynukleotidinin  yerləşməsı  ana  zəncirin  uzadılmasının 

dayandırılması ilə nəticələnir.  

Misal olaraq, “G” tyubuna baxdıqda, müxtəlif məhsullara rast 

gəlmək mümkündür.  

Sonra zəncirvari polimeraza reaksiyası yerinə yetirilir və hər 

tyubda olan PZR məhsulları poliakrilamid geli üzərində 

elektroforez edilir.   

 

3'



CTTACAGGAAAGAGATTC

AGGATTCAGGAGGCCTACCATGAAGATCAAG

5' 




5'

TCCTAAGTCCTCCGGATGGTACTTCTAGTTC

3'

 

5'

GAATGTCCTTTCTCTAAG

3' 

Praymer  


1974-cü  ildən  bəri  texnologiyaların  təkmilləşdirilməsi  sahəsində  əldə  olunmuş 

çoxsaylı  nailiyyətlərin  mövcudluğu  tədricən  Sanger  üsulunun  köhnəlməsində 

təəccüb  doğurmur.  Lakin  Sanger  metodunu  əvəz  edən  yeni  texnologiyaların 

hamısı  Sanger  üsulunun  işləmə  prinsiplərinə  əsaslanır.  Avtomatlaşdırılmış 

sequencing  qısa  zaman  fasiləsində  genomun  böyük  hissəsinin  oxunmasına 

şərait yaradır.  

Avtomatlaşdırılmış prosesdə ddNTP-lərin hər biri fərqli rənglərlə etiketlənir və 

bir yerdə bütün reaksiyalar yalnız bir tyub daxilində yerinə yetirilir.         



Ion Torrent 

 

İon  yarımkeçirici  sekvenator  (Ion  semiconductor  sequencing)  DNT–nin  



polimerləşməsi  nəticəsində  ayrılan  hidrogen  ionu  əsasında  DNT  ardıcıllığının 

oxunma metodudur.    

 





Mikro  çiplər  üzürində  milyonlarla  mikroyuvacıqlar  (microwells)  mövcuddur.  Bir 

zəncirli  DNT  fraqmentlərinin  hər  biri  amplifikasiya  nəticəsində  müxtəlif  sayda  bir 

beadlə  birləşərək,  təsadüfi  şəkildə  çiplərdəki  yuvacıqlarda  paylanırlar.  Hər  bead  bir 

fraqment deməkdir, beləliklə, milyonlarla bead milyon fraqmentin təzahürü deməkdir.   

 




Hər yuvacıq altında ISFET (

ion-sensitive field-effect transistor

) adlı ion sensor mövcuddur.  





Dostları ilə paylaş:


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©genderi.org 2019
rəhbərliyinə müraciət

    Ana səhifə