Yumşaq Buğda (Triticum aestivum L.) Genotiplərində Tdicdrf1 Geninin Tək Nukleotid Polimorfizmləri (tnp) Əsasında Müqayisəli Tədqiqi



Yüklə 144,81 Kb.

tarix29.04.2018
ölçüsü144,81 Kb.


АМЕА-nın Xəbərləri (biologiya və tibb elmləri), cild 72, №1, səh. 98-104 (2017)

 

98 



Yumşaq Buğda (Triticum aestivum L.) Genotiplərində TdicDRF1 Geninin Tək 

Nukleotid Polimorfizmləri (TNP) Əsasında Müqayisəli Tədqiqi 

 

C. Mürsəlova



*

, Z.İ. Əkpərov 

 

AMEA Genetik Ehtiyatlar İnstitutu, Azadlıq prospekti, 155, Bakı AZ1106, Azərbaycan; 



*

E-mail: m.jamala85@gmail.com 

 

Tədqiqat işində 48 payızlıq yumşaq buğda genotipində TdicDRF1 (ABA- asılı olmayan) transkripsiya 



faktorunu kodlaşdıran genin skrininqi aparılmış və bir hissəsinin sekvenslənməsi yerinə yetirilərək tək 

nukleotid  polimorfizmlərinə  görə  müqayisə  edilmişdir.  Tədqiq  olunan  nümunələrin  amplifikasiya 

olunmuş  gen  fraqmentində  ümumilikdə,  94  tək  nukleotid  polimorfizmi  (TNP)  müəyyən  olunmuşdur 

ki,  onlardan  48-i  tranzisiya,  27-si  isə  transversiya  tipli  TNP-lərə  aid  olub,  umümi  polimorfizmin 

müvafiq olaraq 51 və 29%-ni təşkil etmişlər. 

 

Açar sözlər: TNP, sekvens, transkripsiya amili, abssiz turşusu, TdicDRF1 

 

 

GİRİŞ 



 

Quraqlıq  ən  şiddətli  stres  amillərindən  olub, 

bitkilərin,  demək  olar  ki,  bütün  funksiyalarına  təsir 

göstərir.  Bitkilərdə  quraqlıq  stresinə  qarşı  cavab 

reaksiyasında  iştirak  edən  gen  məhsulları  2  əsas 

qrupa  ayrılır:  funksional  və  tənzimləyici  zülallar. 

Birinci qrupa aid olan genlərin əsas funksiyası stresə 

tolerantlığı  təmin  edən  zülalları  sintez  etməkdir  (su 

kanal  proteinləri,  osmotik  qoruyucuların  biosinte-

zində iştirak edən enzimlər, LEA (gec embriogenez) 

zülalları və s.). İkinci qrupa isə stresə qarşı cavabda 

rol oynayan, genlərin ekpresiyasının və siqnal ötürül-

məsinin  tənzimlənməsini  həyata  keçirən  proteinki-

nazlar, transkripsiya amilləri (bZIP, MYC, MYB and 

DREB)    və  s.  zülallar  daxildir  (Əliyev  və  b.,  2014; 

Shinozaki and Yamaguchi 1997). 

Bitkilərin quraqlıq stresinə reaksiyasının trans-

kripsiya  səviyyəsində  tənzimlənildiyi  məlumdur. 

Bu  stres  amilinin  təsiri  zamanı  transkripsiya  sə-

viyyəsində tənzimlənmənin abssiz turşusundan asılı 

(ABT  asılı)  və  yaxud  aslı  olmayan  (ABTasılı  ol-

mayan)  və  DREB  zülalları  vasitəsilə  icra  olunan 

(dehydration-responsive element binding protein) 2 

əsas  tsikli  induksiya  olunur  (Irada  et  al.,  2010; 

Hikmet et al., 2013). 

Məlumdur  ki,  abssiz  turşusu  (ABT)  bitkilərin 

inkişaf proseslərində iştirak etməklə, streslə əlaqəli 

yolları induksiya edən bitki hormonudur. O, su stre-

si  şəraitində  sintez  olunur  və  quraqlığa  qarşı  tole-

rantlıqda  əhəmiyyətli  rol  oynayır  (Hikmet  et  al., 

2013).  ABT-nin  quraqlığa  davamlılığı  artırdığı, 

yaşlaşmanı  gecikdirdiyi,  fizioloji  və  ya  mühit  qu-

raqlığında  bitkilərin  canlı  qalmasını  təmin  etdiyi 

tədqiqatlarla  sübut  edilmişdir  (Shinozaki    and  Ya-

maguchi, 2000). 

ABT-dan  asılı  yolda  əsasən  antioksidləşdirici 

və  osmotik  qoruyucular  iştirak  etdiyi  halda,  ABT-

dan asılı olmayan yolda əsas rolu qoruyucu zülalar 

oynayır. ABT-dan asılı olmayan yol həm də DREB 

vasitəli  yol  adlanır  və  əsasən  suzuzluğa  cavabdeh 

elementləri  birləşdirən  (DREB)/C-təkrarları  motiv-

ləri  (CRT)  zülallarını  özündə  cəmləyir.  Onlardan 



DREB1 transkripsiya faktoru əsasən soyuq stresinə, 

DREB2 isə quraqlıq stresinə qarşı reaksiyada iştirak 

edir  (Agarwal  et  al.,  2006).  Onlar  transkripsiya 

amillərinin  ERF  (ethylene  responsive  element  bin-

ding  factors)  qrupuna  məxsusdurlar.  Arabidopsis 

bitkisində 124-dən çox ERF zülalları olduğu müəy-

yən  edilmişdir 

(Riechmann  et  al.,  2000).  DREB2-

nin homoloqu olan TdicDRF1 transkripsiya faktoru 

ilk dəfə yabanı buğdalarda (

T. turgidum ssp. Dicoc-

coides

)müəyyən  edilmiş,  klonlaşdırılmış  və  xarak-

terizə  edilmişdir  (Lucas  et  al.,  2011).  Quraqlıq 

stresinə  həssas  və  davamlı  genotiplərin  müqayisəsi 

nəticəsində  TdicDRF1  transkripsiya  amilinin  müx-

təlif  cür  ekspresiya  olunduğu  müəyyən  edilmişdir. 

Beləliklə,  həmin  transkripsiya  amilinin  quraqlıq 

stresinə  cavab  reaksiyasında  rolu  nəzərə  alınaraq 

quraqlığa  tolerant  buğda  sortlarının  yaxşılaşdırıl-

masında  istifadə  oluna  bilər  (

Hikmet  et  al.,  2013; 

 

Lucas et al., 2011)



Məlumdur  ki,  tək  nukleotid  polimorfizmləri 

(TNP)  istənilən  növün  fərdləri  arasında  müşahidə 

edilən  ən  ümumi  polimorfizm  növüdür  (Brookesç 

1999;  Deschamps  and  Campbell,  2010). TNP-lərin 

kəşfi, onların genetik marker kimi istifadəsi yüksək 

keyfiyyətli analizlərin aparılmasına və TNP-lər va-

sitəsilə  genotipik  qiymətləndirmə  platformalarının 

inkişafına  səbəb  olmuşdur  (Edwards  et  al,  2008;, 

Ganal et al., 2009; Varshney et al., 2009). 

Tədqiqat işində əsas məqsəd 48 müxtəlif mən-

şəli  yumşaq  buğda  genotipində  quraqlığa  davamlı 



TdicDRF1  transkripsiya  amilini  kodlaşdıran  genin 

mövcudluğunun yoxlanılması və gendə tək nukleo-

tid  polimorfizmlərinin  (TNP)  müəyyən  edilməsin-

dən ibarət olmuşdur. 




Yumşaq Buğda (T. aestivum L.) genotiplərində 

99 


MATERİAL VƏ METODLAR 

 

Tədqiqat  materialı  Buğda  və  Qarğıdalının 



Yaxşılaşdırılması  üzrə  Beynəlxalq  Mərkəzdən 

(CYMMIT)  əldə  olunmuş  müxtəlif  mənşəli  48  pa-

yızlıq yumşaq buğda genotipindən (sort və yaxşılaş-

dırılmış  xətlər)  ibarət  olmuşdur  (Cədvəl  1).  Buğda 

nümunələrindən  DNT-nin  ayrılması  Varşava  Təbiət 

Elmləri 


Universitetinin  (SGGW)  “Molekulyar 

biologiya”  laboratoriyasında,  Thompson  və  Murray 

təklif  etdiyi  və  sonradan  modifikasiya  olunmuş 

CTAB  (Cetyltrimethyl  ammonium  bromide)  proto-

kolu  əsasında  yerinəyetirilmişdir  (Murray  and 

Thompson,  1980).Ayrılmış  DNT-nin  keyfiyyəti  və 

qatılığı  Nanodrop  2000  cihazı  ilə  təyin  edilmiş  və 

tələb olunan qatılıq üzrə durulaşdırılmışdır (5 ng/µl). 

PZR  reaksiya  qarışığının  ümumi  həcmi  bir 

nümunə üçün 15μl olmuşdur. Hər reaksiya qarışığı 

5ng/µl  DNT,  1XPZR  (1X  Green  GoTaq®  Reac-

tion Buffer) buferi (0,5 mM MgCl

2

, 0,2 mM dNTP-



lər, 0,2 mM düzünə, 0,2 mM  əksinə praymer, 0,02 

U/µl Taq polimeraza fermentindən ibarət olmuşdur. 

Zəncirvari Polimeraza Reaksiyası (APPLIED, Gene 

Amp., PCR System 9700) aparatında 3 mərhələdən 

və  37  tsikldən  ibarət  proqram  əsasında  yerinə 

yetirilmişdir. 

PZR  reaksiyası  tamamlandıqdan  sonra  reak-

siya  məhsulu  1%-li  aqaroza  gelində  və  220  V  gər-

ginlikdə,  40-45  dəqiqə  müddətində  elektroforez 

olunmuşdur.  Gellər  Molecular  Imager®Gel  Doc™ 

XR  system  (Bio-Rad)  cihazı  vasitəsilə  UV  şüaları 

altında görüntülənmişdir. 



TdicDRF1 transkripsiya amilinə müvafiq pray-

merlərin dizayn  olunması üçün  həmin  genin  NCBI 

(Milli  Biotexnologiya  İnformasiya  Mərkəzi)  məlu-

mat  bazasında  mövcud  olan  mRNA  ardcıllığından 

(GenBank:  HM015905.1)  istifadə  olunmuşdur. 

Tədqiq olunan geni tam  əhatə etmək üçün Primer3 

(http://primer3.ut.ee)  proqramının  istifadəsi  ilə  bir-

birinin üzərini örtən (overlapping) 3 müxtəlif pray-

mer  dizayn  edilmişdir.  Dizayn  olunmuş  praymer-

lərin  keyfiyyəti  Oligoanalyzer  (https://www.idtdna. 

com/calc/analyzer)  və  Primer  Stat  (http://www. 

biomol.unb.br/sms2/pcr_primer_stats.html) 

proq-

ramları  ilə  yoxlanılmışdır.  Şərti  olaraq  1ABA, 



2ABA  və  3ABA  adlandırılmış  praymerlər  Geno-

med  şirkətindən  əldə  edilmiş  və  protokola  uyğun 

olaraq  durulaşdırılmışdır.  İstifadə  olunmuş  pray-

merlərin siyahısı Cədvəl 2-də verilmişdir. 

Genin 3ABA praymeri vasitəsilə amplifikasiya 

olunmuş  3′  sonluğuna  yaxın  fraqmenti  Genomed 

şirkətində, Sanger metodu ilə sekvens olunmuşdur. 

Əldə  olunmuş  nəticələr  Chromas  LITE  2.1.1

CAP3, MEGA6, Tassel 5 və BioEdit kimi bioinfor-

matik proqramların köməyilə analiz edilmişdir. 

 

 

Cədvəl 1. Tədqiqat işində istifadə olunmuş 48 payızlıq yumşaq buğda genotipləri

 

№ 



Nümunələr 

Mənşəyi 

№ 

Nümunələr 

Mənşəyi 

1.

 

 

SG-U 8069 

CZ 

25. 

COMP1/5/BEZ//TOB/8156/4/ON/3/TH*6/KF//LEE

*6/K/6/TAST/SPRW../7/ALTAY/8/BURBOT-6 

TCI 


2.

 

 

GOBUSTAN 

AZB 

26. AGRI/NAC//ATTILA 

MX-CIT 


3.

 

 

KRASNOVODOPADSKAYA 211 

KAZ 

27. DESTIN 

RO-FL 


4.

 

 

PROSTOR 


BG 

28. DEMIR 

TR-ANK 


5.

 

 

GEREK 


TR-ESK 

29. DYUOPEBUSA 

MOL 


6.

 

 

UBILEYNAYA 100 

RUS-KR 

30. OK00421 

USA-OK 


7.

 

 

BAYRAKTAR 

TR-ANK 

31. ALTAY 

TR-ESK 


8.

 

 

HAMSI-1 


MX-TCI 

32. AKINCI-84 

AZB 


9.

 

 

BEZOSTAYA1 

TR-ESK 

33. GRS1201/TAM202 

US-ARS-Lincoln 



10.

 

 

KARAHAN 


TR-KON 

34. MIMA 

BG 


11.

 

 

MVMA/MV12//F2098 

HU-MV 

35. NIKONIYA 

UKR-OD 


12.

 

 

STARSHINA 

RUS-KR 

36. LC924/PETJA 

UKR-OD 


13.

 

 

CO 970547-7 

USA-CO 

37. PODOIMA 

BG-SAD 


14.

 

 

ZUBKOV 


KYR 

38. STEKLOVIDNAYA24 

MOL 


15.

 

 

MV06-02 


HU-MV 

39. DALNITSKAYA 

KAZ 


16.

 

 

GLORIA 


RO-FL 

40. VITA 

UKR 


17.

 

 

LC 909 MIMA 

BG-KC 

41. KHARKOVSKAYA107 

RUS-KR 


18.

 

 

TX96V2847 

US-TX 

42. AZERI 

AZB 


19.

 

 

U1254-1-8-1-1/TAM-202 

USA-TX 

43. 453 

KAZ 


20.

 

 

SONMEZ 


TR-ESK 

44. SG-S1915 

CZ 


21.

 

 

ARLIN/YUMA 

USA-KSU  45. MADSEN/MALCOLM 

OSU 


22.

 

 

ERITR 9945 

KYR 

46. 7C/CNO//CAL/3/YMH/4/VP... 

OSU 


23.

 

 

GRUIA 


RO-FL 

47. ID 80-628/3/CER/YMH... 

OSU 


24.

 

 

MV DALMA 

HU-MV 

48. U1254-7-9-2-1/TX86A5616//RINA-6 

TCI 


 

 

 




Mürsəlova və Əkpərov

 

100 



Cədvəl 2.  Dizayn edilmiş praymerlər və onların əsas göstəriciləri 

GenBank: HM015905.1  

Triticum turgidum subsp. dicoccoides DRE-binding transcription factor 1.3 mRNA, complete cds 

Praymer: 1ABA 

Praymer   

Başlandığı mövqe  uzunluq 

T



GC% 

Ardıcıllıq 5



 - 3

′ 

Düzünə praymer           

22 


67.77 

59.09 


TGACGGTAGATCGGAAGGACGC 

Self dimer         

 

Delta G: -4,62 kkal/mol 



Əksinə praymer        

333 


22 

63.55 


50.00 

CCTCTTTGAACCCTGTGGATCA 



Self dimer         

 

Delta G: -4,62 kkal/mol 



Hetero dimer 

Delta G: -4,67 kkal/mol 

İlgək 

əmələ gətirmir 



Praymer: 2ABA 

Praymer   

Başlandığı mövqe  uzunluq 

T



GC% 

Ardıcıllıq 5



 - 3



 

Düzünə praymer           

312 

22 


63.55 

50.00 


TGATCCACAGGGTTCAAAGAGG 

Self dimer         

 

Delta G: -4,62 kkal/mol 



Əksinə praymer        

751 


22 

60.10 


50.00 

CATCTGGCTGGGAGTAAATCTC 



Self dimer         

 

Delta G:  -3, 17 kkal/mol 



Hetero dimer 

Delta G: -5,02 kkal/mol 

İlgək 

əmələ gətirmir 



Praymer: 3ABA 

Praymer   

Başlandığı mövqe  uzunluq 

T



GC% 

Ardıcıllıq 5



 - 3



 

Düzünə praymer           

730 

22 


60.10 

50.00 


GAGATTTACTCCCAGCCAGATG 

Self dimer         

 

Delta G: -3,17 kkal/mol 



Əksinə praymer        

1150 


21 

60.00 


47.62 

ACTCGCTCATCTCAGCATCAT 



Self dimer         

 

Delta G:  -4,74 kkal/mol 



Hetero dimer 

Delta G: -6,6 kkal/mol 

İlgək 

əmələ gətirmir 



 

 

NƏTİCƏLƏR VƏ ONLARIN MÜZAKİRƏSİ 

 

Məlum  olduğu  kimi  hazırda  genomiks  haq-



qında  məlumatlar  müxtəlif  açıq  girişli-ictimai  və 

girişi  məhdudlaşdırılmış  fərdi  məlumat  bazaların-

da saxlanılır. Ən çox istifadə edilən və ictimaiyyət 

üçün  açıq  olan  məlumat  bazası  Milli  Biotexnolo-

giya  İnformasiya  Mərkəzi  (MBİM-NCBİ)  tərəfin-

dən idarə olunur. Tədqiqat işində, ilk növbədə öy-

rənilən  genin  amplifikasiyası  məqsədilə  buğdanın 

Triticum  turgidum  subsp.  dicoccoides  yarım-nö-

vünün TdicDRF1 transkripsiya amilinin 1167 nuk-

leotid  cütündən  ibarət  olan  mRNT-nin  ardıcıllığı 

(GenBank:  HM015905.1)  MBİM  məlumat  baza-

sından  yüklənilmiş  və  üç hissəyə ayrılaraq  müəy-

yən  sahələrdə  bir-birinin  üzərini  örtən  (overlap-

ping) üç cüt praymer dizayn edilmişdir (Cədvəl 2). 

Məlumdur ki, hər bir  PZR reaksiyasının səmərəli-

liyi və həssaslığı istifadə olunan praymerin keyfiy-

yətindən  çox  asılıdır.  Belə  ki,  praymerlərin  uzun-

luğu,  birləşmə  temperaturu,  GC  tərkibi  və  ardı-

cıllığı və s. əsas göstəricilər hesab olunduğundan, 

onların  dizayn  edilməsi  zamanı  bütün  qeyd  olu-

nanlar  nəzərə  alınmış,  düzünə  və  əksinə  praymer-

lərin özləri (self dimer) və ya bir-birləri ilə (hetero 

dimer)  dimer,  həmçinin  ilgək  (hairpin)  əmələ  gə-

tirmə  ehtimalları  yoxlanılmışdır  (Singh  and  Ku-

mar, 2001). İlkin olaraq praymerlər 10 ədəd müx-

təlif  mənşəli  buğda  genotiplərində  tədqiq  olunan 

genin  amplifikasiyası  üçün  istifadə  edilmiş  və 

aqaroza  gelində  alınmış  nəticələrə  əsasən  1ABA 

paymeri  vasitəsilə  sintez  olunmuş  fraqmentlərin 

uzunluğunun  2000-3000  n.c.,  2ABA  və  3ABA 

praymerləri  vasitəsilə  sintez  olunmuş  fraqmentlə-

rin uzunluğunun isə 300-400 n.c.-ə bərabər olması 

müəyyənləşdirilmişdir.  Bu  isə  birinci  fraqmentin 

həm intron və ekzonlardan ibarət oldugunu söylə-

məyə  əsas  vermişdir.  Digər  sintez  olunan  fraq-

mentlərin  uzunluğu  isə  praymerlərin  dizayn  edil-

məsi  zamanı  gözlənilən  uzunluğa  bərabər,  yəni 

yalnız mRNT-də təmsil olunan müəyyən bir hissə-

yə  uyğun  olmuşdur  ki,  bu  da  onların  yalnız  genin 

hər hansısa bir ekzonuna aid hissəni əhatə etməsi-

ni  göstərir.  Növbəti  mərhələdə  tədqiq  olunan  48 

nümunənin  hamısında  hər  üç  praymerin  istifadə-

silə  TdicDRF1geninin  olub-olmaması  yoxlanılmış 

və  nəticədə  bütün  genotiplərdə  qeyd  edilən  genin 

amplifikasiyasının  getməsi  müşahidə  edilmişdir. 

Bütün  tədqiq  olunan  buğda  genotiplərində 



TdicDRF1  geninin  mövcudluğu  aşkar  edildikdən 

sonra  genin  3′  sonluğundakı  təxminən  424  n.c. 

uzunluqlu fraqmentinin Sanger üsulu  əsasında hər 

iki  istiqamətdə  (düzünə  və  əksinə  zəncirlərin  hər 

biri) sekvenslənməsi həyata keçirilmişdir. 

Alınmış  xromatoqramlardahəqiqi  polimorfizm 

ilə sekvensin xətası Chromas LITE 2.1.1 kompyuter 

proqramı vasitəsilə müəyyənləşdirilmişdir. Belə ki, 

sekvens üçün istifadə olunmuş DNT-nin keyfiyyəti 

və  ya  miqdarı  aşağı  olduqda,  yaxud  oxunuşda  hər 

hansı  bir  xəta  baş  verdikdə  bu  proses  xromato-

qramdakı  dalğalarda  əlavə  simvollar  şəklində  öz 

əksini tapır (məsələn N, Y və s.).  



Yumşaq Buğda (T. aestivum L.) genotiplərində 

101 


 

 

 



 

 

 



Şəkil 1. 3ABA praymeri vasitəsilə amplifikasiya olunmuş franqmentlər.  

 

 



 

Şəkil 2. Tək nukleotid polimorfizminin (TNP) müəyyən edilməsi, TASSEL 5.0.8

 

 

Daha  sonra  fraqmentin  düzünə  və  əksinə  isti-



qamətdə oxunmuş eyni fraqmentləri FASTA forma-

tına salınaraq CAP3 proqramından istifadə edilmək-

lə  kontiqlər  (contigs-contiguous  sequences)  əldə 

olunmuş  və  bütün  nümunələrin  kontiqləri  BioEdit 



Sequence  Alignment  Editor  proqramı  vasitəsilə 

düzləndirilmişdir (alignment). Sonra TASSEL 5.0.8 

bioinformatik proqramının istifadəsi ilə bütün öyrə-

nilən  genotiplərin  eyni  gen  fraqmentində  tək  nuk-

leotid  polimorfizmləri  (TNP)  müəyyən  edilmişdir. 

Tək  nukleotid  polimorfizmlərinə  daha  çox  geno-

mun  kodlaşdırmayan  hissələrində  rast  gəlinsə  də, 

kodlaşdırıcı və ya tənzimləyici funksiyalı regionlar-

da  da  müşahidə  olunurlar.  Gendəki  yerinə  görə 

TNP-lər  exon,  intron  və  promotor  TNP-lər  kimi 

fərqləndirilir. Kodlaşdırıcı sahələrdəki bu cür müx-

təlifliklər  isə  sinonim  və  qeyri-sinonim  TNP-lər 

kimi  təsnifləşdirilir.  Qeyri-sinonim  TNP-lər  zülal 

ardıcıllığında  həmin  kodonun  kodlaşdırdığı  amin 

turşularının dəyişməsinə səbəb olur və bu dəyişiklik 

amin turşularının xarakterindən asılı olaraq konser-

vativ  və  qeyri-konservativ  olur.  Qeyri-konservativ 

dəyişiklik  yaradan  polimorfizm,  zülallarda  struktur 

dəyişikliyinə  səbəb  ola  bilər  ki,  bu  da  nəticədə 

onların  funksiyasını  dəyişir.  Sinonim  tipli  mutasi-

yalar  zamanı  yaranan  polimorfizm  zülalda  amin 



Mürsəlova və Əkpərov

 

102 



turşularının dəyişilməsinə səbəb olmur. Nuk-leotid-

lərin variasiyasına əsasən isə TNP-lərin 2 növü mə-

lumdur: tranzisiya və tranversiya. Tranzisiya zama-

nı purinlər purinə (A – G), primidinlər isə primidinə 

çevrilir (C – T). Transversiya tipli dəyişilmə zama-

nı isə (A – C, A – T, G – C, G – T) purinlər primi-

dinə, primidinlər isə purinə çevrilir.   

3ABA  praymeri  vasitəsilə  amplifikasiya  olun-

muş  424  n.c.-dən  ibarət  gen  fraqmentində  ümumi-

likdə  94  TNP  müəyyən  edilmişdir  (Cədvəl  3,  ixti-

sarla).  Bunlardan  48-i  tranzisiya  tipli  TNP-lərə  aid 

olub  umümi  polimorfizmin  51%-ni,  27-i  isə  trans-

versiya  tipli  TNP-lərə  aid  olub  29%-ni  təşkil  et-

mişdir. Həmçinin öyrənilən fraqmentin 342 və 369 

n.c.  mövqelərində  2  İnDel  (insersiya  və  yaxud 

delesiya), 17 halda isə bir nukleotidin 3 fərqli nuk-

leotidlə əvəz olunması müşahidə olunmuşdur (məs. 

A/T/C).  Nəzəriyyədə  qeyd  olunur  ki,  nukleotid 

transversiyalarının  sayı  tranzisiyaların  sayından  2 

dəfə çoxdur, əksinə tranzisiyaların rastgəlmə tezliyi 

1,5-2,5  ədəd  transversiyaların  tezliyindən  yüksək-

dir. Bu isə CpG dinukleotidlərində 5-metilsitozinin 

timidinə  görə  yüksək  spontan  deaminləşmə  (amin 

qrupunun  ləğv  edilməsi)  səviyyəsi  ilə  izah  oluna 

bilər (Khlestkina and Salina 2006). 

 

 



 

Cədvəl 3. Gen fraqmentində müəyyən edilmiş Tək Nukleotid Polimorfizminin (TNP) mövqeyi (ixtisarla)

 

TNP-nin növü və 

mövqeyi 

TNP-lərin rast 

gəlmə tezliyi 

Genotiplər üzrə nukleotid əvəzedilmələri 

T/A (1) 


27/21 

 

 



56% T 

44% A 


T- 

G 2; 4; 5; 6; 7; 9; 10; 11; 12; 13; 14; 15; 16; 18; 19; 21; 23; 24; 27; 30; 34; 35; 36; 38; 41; 

42; 48 



G 1; 3; 8; 17; 20; 22; 25; 26; 28; 29; 31; 32; 33; 37; 39; 40; 43; 44; 45; 46; 47 



T/G (2) 

31/17 


 

 

65% T 



35% G 

T- 


G1; 2; 7; 9; 10; 14; 15; 17; 19; 20; 21; 25; 26; 27; 28; 29; 31; 34; 35; 36; 37; 39; 40; 41; 42; 

43; 44; 45; 46; 47; 48 

G3; 4; 5; 6; 8; 11; 12; 13; 16; 18; 22; 23; 24; 30; 32; 33; 38 



T/C (10) 

43/5 


 

90% T 


10% C 

T- 


G 1-10; 13-19; 21-29; 31-33; 35-48 

G11; 12; 20; 30; 34 



G/T (17) 

45/3 


 

94% G 


6% T 

G- 


G 1-2; 4-7; 9-37; 39-48 

T  


G 3, 8; 38 

 

 



G5

G

38



G

22

G8



G4

G3

G



30

G32


G33

G23


G24

G16


G6

G18


G26

G1

G25



G11

G2

G



14

G

29



G

42

G9



G

20

G



41

G

28



G

35

G



46

G

45



G

31

G



40

G

17



G47

G44


G43

G19


G48

G39


G12

G34


G10

G36


G37

G

21



G

13

G



15

G

27



G7

0.005


 

 

Şəkil 3. TNP-lər əsasında 48 yumşaq buğda genotipinin  

klaster analizi vasitəsilə qruplaşdırılması

 



Yumşaq Buğda (T. aestivum L.) genotiplərində 

103 


MEGA6 bioinformatik proqramı vasitəsilə gen 

fraqmentində  müəyyən  edilmiş  TNP-lər  əsasında 

Kimura 2-parameter metodundan istifadə edilməklə 

genetik  məsafə  matrisi  qurulmuşdur.  Neighbor-

Joining  metodu  və  klaster  analizinin  nəticəsində 

tədqiq  olunmuş  48  yumşaq  buğda  genotiplərinin 

424  n.c.  uzunluqlu  sekvesnlərində  mövcud  olan 

TNP-lər  nümunələri  2  əsas  və  5  yarım-klasterə 

ayırmışdır. 

1-ci  yarımqrup  klaster  müxtəlif  mənşəli  13 

genotipi  birləşdirərək,  ümumi  genotiplərin  27,1%-

ni  təşkil  etmişdir.  Bu  qrupda  genetik  məsafə  in-

deksinə  görə  genetik  oxşarlıq  əmsalının  minimum 

və  maksimum  qiymətləri  müvafiq  olaraq  0,012-

0,061 arasında dəyişmişdir. Belə ki, yarımqrup da-

xilində  genetik  məsafə  baxımından  ən  yaxın 

genetik  oxşarlıq  0,012  qiymətində  6-cı  (Ubiley-

naya  100)  genotiplə  24-cü  (Mv  Dalma)  genotip 

arasında,  ən uzaq genetik məsafə isə 0,061-ə bəra-

bər  genetik  məsafədə  5-ci  (Gerek)  genotiplə  33-cü 

(Grs1201/Tam202)  genotip  arasında  aşkar  edilmiş-

dir. Genetik məsafə baxımından bir-birinə oxşar (və 

ya  yaxın)  olan  münunələrin  nukleotid  ardıcıllığına 

və TNP tərkibinə nəzər saldıqda, 24 nömrəli geno-

tiplə 6 nömrəli genotipin müqayisəli analizi zamanı 

5  TNP  (3  transversiya  -  60%,  2  tranzisiya  -  40%) 

müəyyən  edilmişdir.  Göstərilən  genotiplərin  424 

n.c. uzunluqlu fraqmentlərində eyni nukleotid möv-

qelərində  tək  nukleotid  əvəzlənməsi  (TNP)  həmin 

nümunələri  eyni  klasterdə  birləşdirərək  onların 

genetik  oxaşarlığını  göstərmişdir.  Genetik  məsafə 

indeksinə  əsasən  bir-birindən  uzaq  olan  münunələr 

TNP-lərin sayına görə daha çox fərqlənmişlər. Belə 

ki,  5-ci  genotiplə  33-cü  genotip  arasında  24  TNP 

müəyyən  edilmiş-dir.  Bunlardan  70,8%-nin  (17) 

transversiya, 29,2%-nin (7) isə tranzisiya tipli TNP-

lər  olduğu  müəyyən  edilmişdir.  2-ci  yarım  qrup 

ümumilikdə 10 genotipi əhatə etmişdir ki, bu da 48 

genotipin 21,7%-ni təşkil etmişdir. 3-cü yarım qrup 

genotiplərin  8,3%-ni  təşkil  edərək,  cəmi  4  nümu-

nədən (G20, G28, G35, G41) ibarət ən kiçik klaster 

kimi  qiymətləndirilmişdir.  Yarımqrup  daxilində 

genetik  oxşarlıq  0,012-0,024  səviyyələrində  dəyiş-

mişdir.  Qeyd  etmək  lazımdır  ki,  bu  yarımqrupda 

geniş  hüdudlu  variasiya  müşahidə  edilməmiş,  belə 

ki,  genotiplər  bir-birindən  çoxda  fərqlənməmişdir. 

Həmçinin yarımqrupa daxil olan digər genotiplərin 

nukleotid ardıcıllığını müqayisə etdikdə də müvafiq 

olaraq  6-7  TNP  (tək  nukleotid əvəzlənməsi)  müşa-

hidə edilmişdir. 4-cü yarımqrup 8 genotipdən ibarət 

olmaqla,  ümumi  dendroqramın  16,7%-ni,  5-ci  ya-

rım-qrup isə 13 genotipi əhatə etməklə, dendroqra-

mın 27,1%-ni təşkil etmişdir. Beləliklə, klaster ana-

lizi  genotipləri  TNP-lərin  sayı  əsasında  qruplaş-

dırmışdır.  Belə  ki,  TNP-lərin  miqdarının  (tək  nuk-

leotid  əvəzlənməsi)  azlığı  genotipləri  oxşar,  çox 

olması isə onları uzaq genotiplər kimi ayırmışdır. 

Gələcək  tədqiqatlarımızda  biz  müəyyən  etdi-

yimiz  TNP-lərdən istifadə edərək TNP əsaslı pray-

merlər dizayn edə bilər və həmin praymerlərdən qu-

raqlığa davamlı buğda sortlarının qiymətləndirilmə-

sində,  eyni  zamanda  seleksiya  proqramlarında  isti-

fadə edə bilərik.  

 

 



MİNNƏTDARLIQ 

 

Tədqiqat  işi  Avropa  Komissiyası  tərəfindən  maliy-

yələşdirilən  Erasmus  Mundus  2-ci  Fəaliyyət  Proq-

ramı çərçivəsində elan olunmuş ALRAKIS II layi-

həsi  əsasında  yerinə  yetirilmişdir.  Tədqiqat  işinin 

həyata  keçməsində  dəstəyi  olan  Varşava  Təbiət 

Elmləri  Universitetinin    (SGGW)    Professoru  Mo-

nika  Rakoczy  Trojanowskaya  və  institutun  “Bitki 

seleksiyası,  Genetikası  və  Biotexnologiyası”  şöbə-

sinin əməkdaşlarına təşəkkür edirik.  

 

 

 



ƏDƏBİYYAT SİYAHISI 

 

Əliyev R.T., Abbasov M.Ə., Rəhimli V.R. (2014) 

Stres və bitkilərin adaptasiyası. Bakı: Elm, 348 s. 



Agarwal P.K., Agarwal P., Reddy M.K., Sopory 

S.K. (2006) Role of DREB transcription factors in 

abiotic and biotic stress tolerance in plants. Plant 



Cell Reports25(12): 1263–1274. 

Brookes  A.  (1999)  The  Essence  of  SNPs.  Gene

234: 177–186. 

Deschamps S., Campbell M. (2010) Utilization of 

next-generation  sequencing  platforms  in  plant 

genomics  and  genetic  variant  discovery.  Mol. 

Breed., 25(4): 553–570.  

Edwards K.J., Poole R.L., Barker G.L.A. (2008) 

SNP discovery in plants. In: Henry R.J. (ed) Plant 



genotyping  II:  SNP  Technology.  Wallingford, 

Oxfordshire, pp. 1–29 



Ganal  M.W.,  Altmann  T.,  Röder  M.S.  (2009) 

SNP  identification  in  crop  plants.  Curr.  Opin. 



Plant Biol., 12: 211–217 

Hikmet  B.,  Melda  K.,  Kuaybe  Y.K.  (2013) 

Drought  Tolerance  in  Modern  and  Wild  Wheat. 



The  Scientific  World  Journal,  Review  Article  ID 

5482462013: 16 p. 

Huseynova I.M., Rustamova S.M. (2010) Screen-

ing  for  drought  stress  tolerance  in  wheat  geno-

types  using  molecular  markers.  Proceedings  of 

ANAS (biological Sciences), 65(5-6): 132-139 

Khlestkina  E.K.,  Salina  E.A.  (2006)  SNP  mar-

kers:  methods  of  analysis,  ways  of  development, 

and comparison on an example of common wheat. 

Genetika42: 725-730. 

Lucas  S.,  Durmaz  E.,  Akpnar  B.A.,  Budak  H. 

(2011) The drought response displayed by a DRE-




Mürsəlova və Əkpərov

 

104 



binding  protein  from  Triticum  dicoccoides.  Plant 

Physiology and Biochemistry49(3): 346–351. 

Murray  M.G.,  Thompson  W.F.  (1980)  Rapid 

isolation  of  high  molecular  weight  plant  DNA. 



Nucleic Acids Res.8: 4321-4326. 

Riechmann  J.L.,  Heard  J.,  Martin  G.  et  al. 

(2000)  Arabidopsis  transcription  factor:  genome 

wide  comparative  analysis  among  eukaryotes. 

Science, 290: 2105–2110 

Shinozaki  K.,  Yamaguchi-Shinozaki  K.  (1997) 

Gene expression and signal transduction in water-

stres response. Plant Physiol., 115: 327-334. 

 

Shinozaki  K.,  Yamaguchi-Shinozaki  K.  (2000) 

Molecular responses to dehydration and low tem-

perature:  differences  and  cross-talk  between  two 

stress signaling pathways. Curr. Opin. Plant Biol., 

3: 217–223/ 

Singh V.K., Kumar A. (2001) PCR primer design. 

Mol. Biol. Today, 2: 27-32 

Varshney R.K., Spurthi N., Nayak S., May G.D., 

Jackson S.A. (2009) Next-generation sequencing 

technologies and their implications for crop gene-

tics  and  breeding.  Trends  Biotechnol.,  27:  522–

530. 


 

 

 

Сравнительное Изучение Гена TdicDRF1 Различных Генотипов Мягкой Пшеницы  

(Triticum aestivum L.) На Основе Однонуклеотидных Полиморфизмов (ОНП) 

 

Д. Мурсалова, З.И. Акпаров 



 

Институт генетических ресурсов НАН Азербайджана 

 

48 генотипов мягкой озимой пшеницы были подвергнуты скринингу на присутствие гена TdicDRF1, 

кодирующего  фактор  транскрипции  (ABA-независимый).  После  частичного  секвенирования  их 

сравнивали  на  однонуклеотидный  полиморфизм.  В  амплифицированных  фрагментах  гена  исследу-

емых  образцов  в  общей  сложности  было  выявлено  94  одиночных  нуклеотидных  полиморфизма 

(ОНП),  48 из которых принадлежали к транзиционному, а 27  - к трансверсному типам, представля-

ющим соответственно 51% и 29% от общего полиморфизма. 

 

Ключевые слова: ОНП, секвенирование, транскрипционный фактор, абсцизовая кислота, TdicDRF1 



 

 

 

Comparative Study Of Different Soft Wheat (Triticum aestivum L.) Accessions Based  

On The Single Nucleotide Polymorphism (SNP) Of The TdicDRF1 Gene 

 

J. Mursalova, Z.I. Akparov 

 

Institute of Genetic Resources, Azerbaijan National Academy of Sciences 

 

In  this  study  48  genotypes  of  bread  winter  wheat  were  screened  for  the  presence  of  the  gene  TdicDRF1 



(ABA-independent) coding the transcription factor and after the partial sequencing  they were compared by 

single-nucleotide  polimophism.  In  total,    94  single  nucleotide  polimophisms  (SNPs)  were  identified  in  the 

amplified  gene fragments  of the studied  samples  and  48  of them  belonged  to  transition,  27  to transversion 

type of SNPs, representing accordingly 51% and 29% of the total polimophism. 



 

Key words: SNP, sequence, transcription factor, abscisic acid, TdicDRF1 

 

 

: uploads -> journal
journal -> Beynin Şərti Reflektor Fəaliyyətinin Emosiogen Tənzimlənməsində Serotoninergik Sisteminin Sinaptik Mexanizmləri
journal -> A sexual violation in an analytic treatment and its personal and theoretical aftermath
journal -> Virtuoz Cərrah, Görkəmli Dövlət Və Elm Xadimi
journal -> Microsoft Word Bas redaktordan
journal -> Və Plastronun Morfoloji Xüsusiyyətləri
journal -> Abşeronda Meyvə Bağlarına Zərərverən Başlıca Qabıqyeyən Böcəklər
journal -> Təbiətin ölkəmizə bəxş etdiyi zəngin sərvətlərə xüsusi qayğı ilə yanaşmaq, belə misilsiz xəzinələri
journal -> Gəncə-Qazax Florasının Nadir Növləri Və Yeni Taksonlar T. S. Bab akişiyeva
journal -> Quraqlıq Və Duz Stresləri Şəraitində Buğda Genotiplərində Rubisko, Rubisko aktivaza Və Fosfoenolpiruvat karboksilazanın Zülal Səviyyələrinin Dəyişilməsi
journal -> Quraqlıq Stresi Zamanı Amarant Yarpaqlarının Sitozol və Mitoxondri Fraksiyalarında nad-malatdehidrogenaza Fermentinin Müqayisəli


Dostları ilə paylaş:


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©genderi.org 2019
rəhbərliyinə müraciət

    Ana səhifə