Title: Relationship between vaginal microbial dysbiosis, inflammation, and pregnancy outcomes in cervical cerclage. One Sentence Summary

DNA extraction and 16S rRNA sequencing

DNA extraction from the BBL CultureSwab was performed as previously described (6). Integrity of the extracted bacterial DNA was confirmed by PCR amplification using universal forward and reverse primers (6). The V1-V3 hypervariable regions of 16S rRNA genes were amplified for sequencing using a forward and reverse fusion primer. The forward primer was constructed with (5′-3′) the Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8 bp barcode, a primer pad (forward: TATGGTAATT), and the 28F-GAGTTTGATCNTGGCTCAG primer (64). The reverse fusion primer consisted of (5′-3′) the Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8 bp barcode, a primer pad (reverse: AGTCAGTCAG), and the reverse primer (519R-GTNTTACNGCGGCKGCTG). Sequencing was performed on an Illumina MiSeq platform (Illumina, Inc.) at Research and Testing Laboratory (Lubbock, TX, USA). Resulting sequence reads were analyzed using the MiSeq SOP Pipeline of the Mothur package (65), which is designed to analyze a multiplexed set of samples. Sequence alignment was performed using the Silva bacterial database (www.arb-silva.de/), and classification of sequences was undertaken using the RDP database reference sequence files and the Wang method (66). OTU taxonomies (phylum to genus) were determined using the RDP MultiClassifier script. Species level taxonomies were determined using USEARCH with 16S rRNA gene sequences from the cultured representatives from the RDP database (67). Sequence alignment data describing the capacity of the V1-V3 amplicons to discriminate Lactobacillus spp. are provided in Table S8 and Fig. S8. Data were re-sampled and normalized to the lowest read count in Mothur (n=689).

Quantitative PCR

Targeted quantitative PCR was carried out to detecct 16S rRNA genes from Atopobium vaginae and Gardnerella vaginalis. The assays were SYBR green based and performed on Applied Biosystem’s StepOnePlus. PCR reaction mixes are as follows: 1x SYBR Green Jumpstart Taq Ready Mix (Sigma-Aldrich), 5 μl of bacterial DNA isolated from the vaginal swabs, and 0.8 µM final concentration of forward and reverse primers. Oligonucleotide primers used for A. vaginae were: forward- 5’-TAGGCGGTTTGTTAGGTCAGGA-3’; reverse- 5’-CCTACCAGACTCAAGCCTGC-3’ (68) and for G. vaginalis; forward- 5’-GGAAACGGGTGGTAATGCTGG-3’; reverse- 5’-CGAAGCCTAGGTGGGCCATT-3’) (69). Thermocycle profile was 95ºC for 2 minutes, followed by 40 cycles at 95ºC for 15 sec and 65 ºC for 1 min. For both assays, vaginal samples and corresponding standards (A. vaginae and G. vaginalis DNA) were run in duplicates, and mean numbers were used to calculate 16S rRNA gene copies per 5 µl of vaginal DNA.

In vitro adhesion assay

Propensity of bacteria to adhere to braided and monofilament suture material was assessed using an in vitro adhesion assay (70). Briefly, 1 cm segments of sterile braided Mersilene or monofilament Ethilon were prepared with a sterile blade and tweezers. Suture fragments were placed into a sterile screw-capped tube and incubated with 1 ml of 100% ethanol for 1 hour at room temperature. Fragments were washed 3x using 1 mL of sterile water before inoculation with E. coli (Nissle 1917) using LB broth and LB plates or Lactobacillus jensenii (Cultech Ltd.) using MRS broth and MRS plates.

For each bacterial isolate we tested the following groups: inoculated Mersilene thread fragments (n=3), uninoculated Mersilene thread fragment (sterility control, n=1), inoculated Ethilon thread fragments (n=3), uninoculated Ethilon thread fragment (sterility control, n=1). An overnight bacterial culture was centrifuged at 3,000 x g for 10 min, and the supernatant was discarded. Cell pellets were resuspended in fresh broth to a final concentration of 10⁷ CFU/mL and 1 mL of this cell suspension was added to each of the suture fragments. For sterility controls, 1 mL of sterile broth was added to an uninoculated Mersilene and Ethilon thread fragment. Suture thread fragments were incubated at 37ºC for 24 h before being washed 3x with sterile PBS and transferred into tubes containing 1 ml of sterile PBS. Each tube was vortexed 3 x for 30 seconds to detach bacterial cells. The cell suspension was vigorously passed through a 25G needle 10 times to break up cell clumps. Aliquots of 100 µL were collected from the cell suspension and used for colony counts on LB or MRS agar plates. After incubation, we used plate colony counts to calculate the CFU/mL of cell suspension. Thread fragment length was accurately measured after cell suspension plating to calculate CFU/cm.

Cytokine Analysis

The transwab cervico-vaginal fluid samples were thawed on ice and resuspended in 350 µL of phosphate-buffered saline solution with protease inhibitor (5 μl/ml; Sigma Aldrich). The suspension was centrifuged at 3000 x g for 2 min and the supernatant collected into a new microcentrifuge tube before repeating the centrifugation step to ensure removal of any cellular debris. Cell-free supernatants were analyzed by Human Magnetic Luminex Screen Assay (15-plex) (Luminex Corporation) with a Bioplex 200 system (Biorad Laboratories Ltd.). Analyte-specific Luminex Screening Assays were performed for 15 analytes: interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, IL-10, granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), monocyte chemotactic protein (MCP)-1, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, regulated on activation normal T expressed and secreted/chemokine ligand 5 (RANTES/CCL5), vascular endothelial growth factor (VEGF), intercellular adhesion molecule 1 (ICAM-1), and matrix metalloproteinase 1 (MMP-1). Analytes were selected according to evidence of involvement in inflammatory change related to preterm birth, cervical ripening, and angiogenesis. Samples were analyzed on 96-well plates at two dilutions (1:1 and 1:50) optimized for detection of analytes within the range of the standards as specified by Luminex Human premixed analyte kit.

Cervical vascularization assessment

Voluson E ultrasound (GE Healthcare) in 3D/4D mode with medium persistence, high sensitivity, and normal line density was used for transvaginal cervical vascular assessment. A sagittal plane of volume acquisition, set at 90°, was analyzed using Virtual Organ Computer-aided AnaLysis software program (VOCAL, GE Medical Systems) (28). The “histogram facility” of the software was used calculated the vascularization index (VI) within the defined volume.