Synthetic Biology | State of the Art
39
3.3.4
Standardisation of genetic parts and modules
Engineering relies on the standardisation. Standards for genetic parts and methods are required for synthetic
biologists to build upon each other’s accomplishments and to make synthetic biology a state of-the-art
discipline (Purnick and Weiss 2009).
A seminal approach towards standardisation in synthetic biology is the BioBrick™ concept. BioBrick™ provides
an open source collection of characterised biological parts and modules. Assembly of BioBricks™ is carried out
by restriction-ligation and all BioBrick™ parts are equipped with compatible restriction sites at their ends.
Moreover metrics for quantitative characterisation of bioparts are being developed, e.g. PoPs (polymerase
operations per second) for transcriptional regulators or RiPS (ribosomal initiations per second) for
translational
regulators. Finally the BioBrick™ foundation is fostering innovation in synthetic biology by organizing the
international genetically engineered machines competition (iGEM) for students (Purnick
and Weiss, 2009).
BioBricks™: The basic building blocks for synthetic biology
In synthetic biology the standardisation of genetic elements used for creating novel genetic regulation units is
a key issue. The crucial goal is to simplify the process of biological engineering (Shetty et al. 2008). To enhance
the dissemination of practical expertise gained in the field of synthetic biology, accelerate the development
process of new biological regulation circuits, improve the reproducibility of the obtained results, increase
transparency in the emerging field the iGEM (internationally Genetically Engineered Machine) organisation is
vigorously promoting open access to such a kind of standardised biological parts. iGEM serves as an
educational and introductory platform trying to comprehensively cover most aspects of synthetic biology. It
organises international competitions for high school and university students in this highly competitive area to
proliferate the technology. As a first step towards streamlining the design process and standardisation in
synthetic biology iGEM is vigorously propagating the concept of BioBricks™-standardised
biological parts which
can be easily used and distributed to construct novel genetic functional complexes (for details see section
below). Only recently iGEM has started to raise the awareness of the participants for biosafety aspects by
requesting a detailed description of biosafety issue relevant for the synthetic constructs submitted for the
competition (Guan et al. 2013).
The BioBricks™ inventory
A DNA sequence which encodes a biological function
i.e. for a promoter, terminator, ribosomal binding site,
protein domain, protein coding sequences etc. is called a “
basic part” (
Figure 10).
A
basic part is a functional unit of DNA which cannot be subdivided
into smaller components. A representative example for a basic part is
the
T7
promoter
(5’taatacgactcactatagggaga3’;
order
code
BBa_I719005) or a phage lambda cI regulated promoter
(5’taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc3’; BBa_R0051).
Figure
10:
Schematic
representation for basic part
“promoter“ in the BioBricks™
assembly (iGEM 2014)
Synthetic Biology | State of the Art
40
A
composite part is a functional unit
of DNA which consists of two
or more several basic parts stacked together (Figure 11). An
example for a composite part is the combination of a ribosomal
binding site, a protein coding region and a terminator spliced
together on a contiguous stretch of DNA forming a functionally
active complex (example: BBa_I13507).
A
device is a variant of a composite part which is capable to
mediate a function in a cellular context. An example of such a
kind of device is the combination of the basic part BBa_R0051
with the composite part BBa_I13507 (Figure 12).
The BioBricks™ standard
“BioBricks™” are standardised biological parts (basic and composite), which conform to the BioBrick™
assembly standard. Adhering to this standard guarantees compatibility between parts and/or to BioBrick™
plasmid carriers and allows that any newly composed part will be ready for recombination with other parts
adhering to the BioBrick™ assembly standard without the need for further genetic manipulation. The
BioBrick™ assembly standard in general takes care for appropriate restriction enzyme target sequences,
compatible multiple cloning sites in carrier vectors and appropriate backbone sequences. This approach allows
the scientist to focus on design of new functions instead of dealing with technical problems concerning cloning
and genetic manipulations.
BioBricks™ are available to the scientific community and may be freely recombined to produce new genetic
entities (Table 3). Information on BioBricks™ is collected and shared via the internet platform Registry of
Standard biological Parts. Physical samples of basic and composite parts may be retrieved from the Registry of
Standard Biological Parts (=Registry Repository) (Shetty et al. 2008).
Figure
11:
Schematic
representation of a composite
part (ribosomal binding site –
protein
coding
region
–
terminator) (iGEM 2014)
Figure
12:
Schematic
representation
of
a
device
consisting of a basic (=promoter)
and a composite part (ribosomal
binding site – protein coding region
– terminator) (iGEM 2014)